| 產品名稱 | Aspergillus niger van Tieghem |
|---|---|
| 商品貨號 | B166767 |
| Strain Designations | A1143 NRRL 3 [3; 320, CBS 120.49, DSM 2466, IMI 41876, N400, NRRL 566, WB 3, WB 566] |
| Application | Produces 4-nitrophenylphosphatase
Produces D-xylulose dehydrogenase
Produces L-malic acid
Produces L-xylulose reductase
Produces acid protease protease (acid)
Produces alpha-L-arabinofuranosidase A
Produces alpha-L-arabinofuranosidase B
Produces citric acid citrate
Produces endo-arabinase
Produces ferulic acid esterase
Produces gluconic acid
Produces glucono-delta-lactone
Produces glucose oxidase
Produces glucuronidase, beta beta-glucuronidase
Produces lincomycin sulfoxides
Produces urease urea amidolyase
Transformation host
Degrades: pulp and paper-mill wastewater
Produces citric acid from whey permeate
Produces gluconic acid in the production of aldonic acid and aldonate compositions useful in cleaning solutions |
| Biosafety Level | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format | freeze-dried |
| Storage Conditions | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain | no |
| Preceptrol® | no |
| Genome Sequenced Strain | Yes |
| Comments | Enhancement of glucose oxidase production by addition of hydrocarbons
Genome sequencing strain (Integrated Genomics Inc, USA). |
| Medium | ATCC® Medium 325: Malt extract agar (Blakeslee's formula) ATCC® Medium 200: YM agar or YM broth ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions | Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGTCTATTGTACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGAACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGAATGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTCTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA D1D2 region of the 28S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGAGTCCGCATTGTAATTTGCAGAGGATGCTTTGGGTGCGGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGGTGTCCGTGCCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGTGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCCTGGAATGTAGTGCCCTCCGGGGCACCTTATAGCCAGGGGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTCGTAAACGAC beta-tubulin gene TTGCCCTCCCCGTCCCTCGTCCGTCAGGAGACGCGTCGTTGGTTGGCATCTCTTTTGCTCGGGACCCCACCGGTTCTTCGACCAACTCATTCTTGTGCTAACTGCATGTCTTCTTCGCTTCATAGGTTCACCTCCAAACCGGCCAGTGTGTAAGTGCCAATATATGCTTCGGATGATTGCCCCCAAGGGTCTTGATTGGTGTTTGGTGGACTAAACAATATATCATGGTGGTTAGGGTAACCAAATTGGTGCTGCTTTCTGGTACGTATACAACTGCCATTGGATTGGGGATGGAACATCGTCTCTTAGGCTATCTCAGCTTGAGTTCAGATGTTGTCCATTAGGTACATGCTATCGGTCTAAGAACACGTCTAACAATTCAACAGGCAGACCATCTCTGGCGAGCACGGCCTTGACGGCTCCGGTGTGTAAGTGCAACTTTTTCACACCTCTCAATTGGTCAACAATGGGCAAAGGGTTGGGTCTTCTGACACGCAGGATAGTTACAATGGCACCTCCGACCTCCAGCTGGAGCGCATGAACGTCTACTTCAACGAGGTGAGATCCATCGGACCTTGGCTTTTTCACGACAATATCATCAATGTCCTAATCACTTCAGCAGGCTAGCGGTAACAAGTATGTTCCTCGTGCCGTCCTCGTCGACCTCGAGCCCGGTACCATGGACGCCGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGCCAGTCCGGTGCTGGTAACAACTGG |
| Name of Depositor | NRRL |
| Chain of Custody | ATCC <-- NRRL <-- Moyer 3 <-- Anthony 320 |
| Cross References | Nucleotide (GenBank) : KU729033 ITS including 5.8S rRNA gene Nucleotide (GenBank) : KU729117 D1/D2 region of 28S rRNA gene Nucleotide (GenBank) : KU897006 beta-tubulin gene Nucleotide (GenBank) : X58892 polygalacturonase gene, pgaI Nucleotide (GenBank) : X55784 pectin lyase gene, pelA, 5' end Nucleotide (GenBank) : J05242 A.niger glucose oxidase mRNA, complete cds. Nucleotide (GenBank) : Z26938 A.niger cprA gene for NADPH cytochrome P450 oxidoreductase. Nucleotide (GenBank) : L19059 subtilisin-like protease gene, pepD, complete coding sequence |
| References | Bercovitz A, et al. Localization of pyruvate carboxylase in organic acid-producing Aspergillus strains. Appl. Environ. Microbiol. 56: 1594-1597, 1990. PubMed: 2383004 Versaw WK, et al. Purification and properties of a 4-nitrophenylphosphatase from Aspergillus niger. Arch. Biochem. Biophys. 287: 85-90, 1991. PubMed: 1654806 Faulds CB, Williamson G. Purification and characterization of a ferulic acid esterase (FAE-III) from Aspergillus niger: specificity for the phenolic moiety and binding to microcrystalline cellulose. Microbiology 140: 779-787, 1994. Witteveen CF, et al. Isolation and characterization of two xylitol dehydrogenases from Aspergillus niger. Microbiology 140: 1679-1685, 1994. Ziffer J, et al. Aldonic acid and aldonate compositions and production thereof. US Patent 3,454,501 dated Jul 8 1969 Argoudelis AD, Mason DJ. Production of lincomycin sulfoxide. US Patent 3,616,244 dated Oct 26 1971 Lakshminarayanan K. Method for the production of glucose oxidase. US Patent 3,701,715 dated Oct 31 1972 Storm AM, Gasner LL. Treatment of pulp mill wastes. US Patent 3,737,374 dated Jun 5 1973 Peppler HJ. Microbial technology. New York: Reinhold; 1967. v.d. Veen P, et al. Induction, purification and characterisation of arabinases produced by Aspergillus niger. Arch. Microbiol. 157: 23-28, 1991. PubMed: 1814275 Jarai G, et al. Cloning and characterization of the pepD gene of Aspergillus niger which codes for a subtilisin-like protease. Gene 139: 51-57, 1994. PubMed: 8112588 Harmsen JA, et al. Cloning and expression of a second Aspergillus niger pectin lyase gene (pelA): indications of a pectin lyase gene family in A. niger. Curr. Genet. 18: 161-166, 1990. PubMed: 2225145 Bussink HJ, et al. Identification and characterization of a second polygalacturonase gene of Aspergillus niger. Curr. Genet. 20: 301-307, 1991. PubMed: 1934135 Jarai G, Buxton F. Nitrogen, carbon, and pH regulation of extracellular acidic proteases of Aspergillus niger. Curr. Genet. 26: 238-244, 1994. PubMed: 7532112 Li TH, Chen TL. Enhancement of glucose oxidase fermentation by addition of hydrocarbons. J. Ferment. Bioeng. 78: 298-303, 1994. Gottschalk TE, et al. Detection of endogenous beta-glucuronidase activity in Aspergillus niger. Appl. Microbiol. Biotechnol. 45: 240-244, 1996. PubMed: 8920195 Smith PT, et al. Isolation and characterization of urease from Aspergillus niger. J. Gen. Microbiol. 139: 957-962, 1993. PubMed: 8336111 Faulds CB, Williamson G. Release of ferulic acid from wheat bran by a ferulic acid esterase (FAE- III) from Aspergillus niger. Appl. Microbiol. Biotechnol. 43: 1082-1087, 1995. PubMed: 8590660 Frederick KR, et al. Glucose oxidase from Aspergillus niger. Cloning, gene sequence, secretion from Saccharomyces cerevisiae and kinetic analysis of a yeast-derived enzyme [published erratum appears in J. Biol. Chem. 265: 11405, 1990]. J. Biol. Chem. 265: 3793-3802, 1990. PubMed: 2406261 Khanh NQ, et al. Effects of promoters on the enhancement of pectin methyl esterase expression in Aspergillus niger. Biotechnol. Lett. 14: 1047-1052, 1992. Dronawat SN, et al. The effects of agitation and aeration on the production of gluconic acid by Aspergillus niger. Appl. Biochem. Biotechnol. 51/52: 347-354, 1995. . . Egypt J. Food Sci. 5: 9-20, 1977. Murray FR, et al. Isolation of the glucose oxidase gene from Talaromyces flavus and characterisation of its role in the biocontrol of Verticillium dahliae. Curr. Genet. 32: 367-375, 1997. PubMed: 9371889 . . Egypt J. Food Sci. 5: 21-29, 1977. Blom RH, et al. Sodium gluconate production. Fermentation with Aspergillus niger. Ind. Eng. Chem. 44: 435-440, 1952. Somkuti GA, Bencivengo MM. Citric acid fermentation in whey permeate. Dev. Ind. Microbiol. 22: 557-563, 1981. Andersen MR, et al. Comparative genomics of citric-acid-producing Aspergillus niger ATCC 1015 versus enzyme-producing CBS 513.88. Genome Res. 21: 885-897, 2011. PubMed: 21543515 Howard SJ, et al. Cryptic species and azole resistance in the Aspergillus niger complex. Antimicrob Agents Chemother 55: 4802-4809, 2011. PubMed: 21768508 Martens-Uzunova ES, Schaap PJ. An evolutionary conserved d-galacturonic acid metabolic pathway operates across filamentous fungi capable of pectin degradation. Fungal Genet Biol 45: 1449-1457, 2008. PubMed: 18768163 Peterson SW. Phylogenetic analysis of Aspergillus species using DNA sequences from four loci. Mycologia 100: 205-226, 2008. PubMed: 18595197 Geiser DM, et al. The current status of species recognition and identification in Aspergillus. Stud Mycol 59: 1-10, 2007. PubMed: 18490947 Semova N, et al. Generation, annotation, and analysis of an extensive Aspergillus niger EST collection. BMC Microbiol 6: 7-7, 2006. PubMed: 16457709 Basten DE, et al. Characterisation of Aspergillus niger prolyl aminopeptidase. Mol Genet Genomics 272: 673-679, 2005. PubMed: 15654623 Poulsen BR, et al. Increased NADPH concentration obtained by metabolic engineering of the pentose phosphate pathway in Aspergillus niger. FEBS J 272: 1313-1325, 2005. PubMed: 15752350 Basten DEJW, Dekker PJT, Schaap PJ. Aminopeptidase C of Aspergillus niger is a novel phenylalanine aminopeptidase. Appl Environ Microbiol 69: 1246-1250, 2003. PubMed: 12571053 de Vries RP, et al. Regulation of the alpha-glucuronidase-encoding gene (aguA) from Aspergillus niger. Mol Genet Genomics 268: 96-102, 2002. PubMed: 12242504 de Vries RP, et al. The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation, and is specifically induced on aromatic compounds. J Biochem 36: 377-386, 2002. PubMed: 11931668 de Vries RP, et al. The beta-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions. Eur J Biochem 269: 4985-4993, 2002. PubMed: 12383257 de Vries RP, et al. Expression profiling of pectinolytic genes from Aspergillus niger. FEBS Lett 530: 41-47, 2002. PubMed: 12387863 |
| 梅經理 | 17280875617 | 1438578920 |
| 胡經理 | 13345964880 | 2438244627 |
| 周經理 | 17757487661 | 1296385441 |
| 于經理 | 18067160830 | 2088210172 |
| 沈經理 | 19548299266 | 2662369050 |
| 李經理 | 13626845108 | 972239479 |
